Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18386371

Morpholino Name: rapgef5 MO1
Synonyms:
Target mRNA: rapgef5

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CTTTAAAAGTCTGACACCCATGAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 25/25
genome
MO
5' GCTCATGGGTGTCAGACTTTTAAAG 3'
   |||||||||||||||||||||||||
3' CGAGTACCCACAGTCTGAAAATTTC 5'
5' GCTTGTGGGTGTCAGACTTTTAAAG 3'
   |||  ||||||||||||||||||||
3' CGAGTACCCACAGTCTGAAAATTTC 5'
5' GCTCATGGGTGTCAGACTTTTAAAG 3'
   |||||||||||||||||||||||||
3' CGAGTACCCACAGTCTGAAAATTTC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6S:32342935..32342959 25/25 Sense target rapgef5.S
Chr6L:40709287..40709311 23/25 Sense target rapgef5.L
Chr5L:57706357..57706381 21/25 Sense unknown
tropicalis 10.0 Chr6:39832844..39832868 25/25 Sense target rapgef5
Publications
First: RAPGEF5 Regulates Nuclear Translocation of β-Catenin., Dev Cell 2018                                                  
Most recent:
View All Papers