Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18385685

Morpholino Name: rarb MO1
Synonyms: RarBeta2.S, Rarb2.S
Target mRNA: rarb

Morpholino Type: uncategorized morpholino
Sequence: 5' TCCCCCCCTATACACAATATTAGCT 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 24/25
genome
MO
5' AGCTAATATTGTGTATAGGGGGGGG 3'
   |||||||||||||||||||||||| 
3' TCGATTATAACACATATCCCCCCCT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6S:40088753..40088777 24/25 Antisense target rarb.S
Chr2L:171871140..171871164 21/25 Antisense off-target rdx.L
Chr1L:200433183..200433207 21/25 Sense off-target fam169a.L
Chr4S:114634112..114634136 21/25 Antisense unknown
tropicalis 10.0 Chr3:142784134..142784158 21/25 Sense unknown
Publications
First: RARβ2 is required for vertebrate somitogenesis., Development 2017                                                
Most recent:
View All Papers