Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18374388

Morpholino Name: hes5.4 MO1
Synonyms: hes8 MO1
Target mRNA: hes5.4

Morpholino Type: translation blocking morpholino
Sequence: 5' AGAAGCCATTTATTGCACTCTGTCT 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 25/25 24/25
genome
MO
5' AGACAGAGTGCAATAAATGGCTTCT 3'
   |||||||||||||||||||||||||
3' TCTGTCTCACGTTATTTACCGAAGA 5'
5' AGACAGAGTACAATAAATGGCTTCT 3'
   ||||||||| |||||||||||||||
3' TCTGTCTCACGTTATTTACCGAAGA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:104033869..104033893 25/25 Sense target hes5.4.L
Chr7S:86979436..86979460 24/25 Sense target hes5.4.S
Chr4S:91584030..91584054 21/25 Antisense off-target kcnt2.S
Chr2L:36107019..36107043 21/25 Sense off-target serpinf1.L
Chr5L:123966227..123966251 22/25 Antisense unknown
Chr1S:120170364..120170388 21/25 Antisense unknown
Chr9_10S:50771108..50771132 21/25 Antisense unknown
tropicalis 10.0 Chr7:29201925..29201949 21/25 Antisense off-target trim8
Chr6:27656565..27656589 21/25 Antisense off-target plxdc2
Chr1:186621794..186621818 22/25 Sense unknown
Chr2:104427644..104427668 21/25 Antisense unknown
Chr2:74271635..74271659 21/25 Sense unknown
Chr8:104269689..104269713 21/25 Antisense unknown
Chr4:146827792..146827816 21/25 Antisense unknown
Publications
First: Six1 and Eya1 both promote and arrest neuronal differentiation by activating multiple Notch pathway genes., Dev Biol 2017                              
Most recent:
View All Papers