Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18374217

Morpholino Name: hspa9 MO1
Synonyms:
Target mRNA: hspa9

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CCGGCACACAGCATGATGAGAGTTA 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 23/25 25/25
genome
MO
5' TCGCTCTCATCATGCTGTGTGCCGG 3'
   |  ||||||||||||||||||||||
3' ATTGAGAGTAGTACGACACACGGCC 5'
5' TAACTCTCATCATGCTGTGTGCCGG 3'
   |||||||||||||||||||||||||
3' ATTGAGAGTAGTACGACACACGGCC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:14329146..14329170 25/25 Antisense target hspa9.S
Chr3L:27851536..27851560 23/25 Sense target hspa9.L
Chr1S:172266694..172266718 21/25 Sense off-target fam169a.S
tropicalis 10.0 Chr1:152778847..152778871 21/25 Sense off-target ccdc74b
Chr4:2483801..2483825 21/25 Sense off-target pik3c2a
Publications
First: Hspa9 is required for pronephros specification and formation in Xenopus laevis., Dev Dyn 2015                        
Most recent:
View All Papers