Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18338852

Morpholino Name: dbf4b MO1
Synonyms: drf1 MO, drf1MO
Target mRNA: dbf4b

Morpholino Type: uncategorized morpholino
Sequence: 5' GCAGAACAGAGATCACACTGGCCAT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' ATGGCCAGTGTGATCTCTGTTCTGC 3'
   |||||||||||||||||||||||||
3' TACCGGTCACACTAGAGACAAGACG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:5522920..5522944 25/25 Antisense target dbf4b.L
Chr8L:49185346..49185370 21/25 Sense unknown
Chr9_10L:104280275..104280299 21/25 Sense unknown
Publications
First: Titration of four replication factors is essential for the Xenopus laevis midblastula transition., Science 2013  
Most recent:
View All Papers