Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18335931

Morpholino Name: ush1g MO1
Synonyms:
Target mRNA: ush1g

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GTGATAGCGCCCGTCCATCCTGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 23/25
genome
MO
5' ATGCAGGATGGACGGGCGCTATCAC 3'
   |||||||||||||||||||||||||
3' TACGTCCTACCTGCCCGCGATAGTG 5'
5' ATGCAGGATGGACGGGCGCTACCAC 3'
   ||||||||||||||||||||| |||
3' TACGTCCTACCTGCCCGCGATAGTG 5'
5' ATGCAGGATGGACGGGCGCTTCCAC 3'
   ||||||||||||||||||||  |||
3' TACGTCCTACCTGCCCGCGATAGTG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:46571328..46571352 24/25 Sense target ush1g.L
Chr9_10S:39034034..39034058 23/25 Sense target ush1g.S
Chr4S:29554680..29554704 23/25 Sense off-target nkd1.S
tropicalis 10.0 Chr10:44147137..44147161 25/25 Sense target ush1g
Publications
First: Usher syndrome type 1-associated cadherins shape the photoreceptor outer segment., J Cell Biol 2017                    
Most recent:
View All Papers