Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18328533

Morpholino Name: rab11fip5 MO1
Synonyms:
Target mRNA: rab11fip5

Morpholino Type: uncategorized morpholino
Sequence: 5' CGAAGAAACATGAGGACGAGCCTCT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' AGAGGCTCGTCCTCATGTTTCTTCG 3'
   |||||||||||||||||||||||||
3' TCTCCGAGCAGGAGTACAAAGAAGC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:9915970..9915994 25/25 Sense target rab11fip5.L
Publications
First: Regulation of distinct branches of the non-canonical Wnt-signaling network in Xenopus dorsal marginal zone explants., BMC Biol 2016                  
Most recent:
View All Papers