Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18018334

Morpholino Name: hace1 MO1
Synonyms: HACE1 MO
Target mRNA: hace1

Morpholino Type: uncategorized morpholino
Sequence: 5' GAGTTGCTCCATTGCTCTCTCCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 25/25
genome
MO
5' GATGGAGAGAGCAATGGAGCAACTC 3'
   |||||||||||||||||||||||||
3' CTACCTCTCTCGTTACCTCGTTGAG 5'
5' GATGGAGAGAGCAATGGAGCAACTC 3'
   |||||||||||||||||||||||||
3' CTACCTCTCTCGTTACCTCGTTGAG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:83737457..83737481 25/25 Antisense target hace1.L
Chr5S:33106447..33106471 21/25 Antisense off-target actn2.S
Chr8S:28007619..28007643 21/25 Sense off-target LOC108699891
tropicalis 10.0 Chr5:80192755..80192779 25/25 Antisense target hace1
Chr2:87797295..87797319 21/25 Sense unknown
Publications
First: The E3 ubiquitin ligase Hace1 is required for early embryonic development in Xenopus laevis., BMC Dev Biol 2016                      
Most recent:
View All Papers