Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18006240

Morpholino Name: pax6 MO2
Synonyms:
Target mRNA: pax6

Morpholino Type: uncategorized morpholino
Sequence: 5' CCAACATCTGCTGATCAACGCCTAG 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 24/25 25/25
genome
MO
5' CTAGGCGTTGATCATCAGATGTTGG 3'
   |||||||||||||| ||||||||||
3' GATCCGCAACTAGTCGTCTACAACC 5'
5' CTAGGCGTTGATCAGCAGATGTTGG 3'
   |||||||||||||||||||||||||
3' GATCCGCAACTAGTCGTCTACAACC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4S:10028235..10028259 25/25 Sense target pax6.S
Chr4L:13847611..13847635 24/25 Antisense target pax6.L
Chr8L:22221762..22221786 22/25 Sense off-target cdk5rap2.L
Chr2S:119125116..119125140 21/25 Antisense unknown
tropicalis 10.0 Chr8:38504563..38504587 22/25 Sense off-target cdk5rap2
Publications
First: Hedgehog-dependent E3-ligase Midline1 regulates ubiquitin-mediated proteasomal degradation of Pax6 during visual system development., Proc Natl Acad Sci U S A 2016                      
Most recent:
View All Papers