Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18006239

Morpholino Name: mid1 MO3
Synonyms:
Target mRNA: mid1

Morpholino Type: uncategorized morpholino
Sequence: 5' TTCCATCTTCAGGCAAAGCTTTCCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 23/25
genome
MO
5' AGGAAAGCTTTGCCTGAAGATGGAA 3'
   |||||||||||||||||||||||||
3' TCCTTTCGAAACGGACTTCTACCTT 5'
5' AGGAAAGCTTTGCCTGAAGATGGAA 3'
   |||||||||||||||||||||||||
3' TCCTTTCGAAACGGACTTCTACCTT 5'
5' AGGAAAGCTTTGTCTAAAGATGGAA 3'
   |||||||||||| || |||||||||
3' TCCTTTCGAAACGGACTTCTACCTT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:80102962..80102986 25/25 Sense target mid1.L
Chr2S:51306771..51306795 23/25 Antisense target mid1.S
Chr6S:71825275..71825299 21/25 Antisense off-target LOC121395089
Chr9_10L:104781960..104781984 21/25 Sense unknown
tropicalis 10.0 Chr2:58550962..58550986 25/25 Antisense target mid1
Chr6:11906457..11906481 21/25 Antisense unknown
Publications
First: Hedgehog-dependent E3-ligase Midline1 regulates ubiquitin-mediated proteasomal degradation of Pax6 during visual system development., Proc Natl Acad Sci U S A 2016                      
Most recent:
View All Papers