Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18005368

Morpholino Name: trabd2a MO1
Synonyms: Tiki1 MO1
Target mRNA: trabd2a

Morpholino Type: translation blocking morpholino
Sequence: 5' CCAAATGATTACCATCATAGCTCAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' CTGAGCTATGATGGTAATCATTTGG 3'
   |||||||||||||||||||||||||
3' GACTCGATACTACCATTAGTAAACC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:122256715..122256739 25/25 Antisense off-target LOC108713414
Chr5S:74528381..74528405 21/25 Antisense unknown
tropicalis 10.0 Chr1:113238089..113238113 25/25 Sense target trabd2a
Publications
First: Tiki1 is required for head formation via Wnt cleavage-oxidation and inactivation., Cell 2012                        
Most recent:
View All Papers