Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17328568

Morpholino Name: daam1 MO2
Synonyms: daam1 MO
Target mRNA: daam1

Morpholino Type: uncategorized morpholino
Sequence: 5' GGCCATGGCCGCAGGTCTGTCAGTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 24/25
genome
MO
5' AACTGACAGACCTGTGGCCATGGCG 3'
   |||||||||||||| ||||||||| 
3' TTGACTGTCTGGACGCCGGTACCGG 5'
5' AACTGACAGACCTGCGGCCATGGCC 3'
   |||||||||||||||||||||||||
3' TTGACTGTCTGGACGCCGGTACCGG 5'
5' AACTGACAGACCTGTGGCCATGGCC 3'
   |||||||||||||| ||||||||||
3' TTGACTGTCTGGACGCCGGTACCGG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:94455635..94455659 25/25 Sense target daam1.L
Chr8S:7411569..7411593 24/25 Antisense target daam1.S
tropicalis 10.0 Chr8:103047459..103047483 23/25 Sense target daam1
Publications
First: Vangl2 cooperates with Rab11 and Myosin V to regulate apical constriction during vertebrate gastrulation., Development 2015                          
Most recent:
View All Papers