Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17328100

Morpholino Name: rai1 MO2
Synonyms:
Target mRNA: rai1

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GGGATTTTTCTGCTCCTATAAGCCA 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' TGGCTTATAGGAGCAGAAAAATCCC 3'
   |||||||||||||||||||||||||
3' ACCGAATATCCTCGTCTTTTTAGGG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10S:106533942..106533966 25/25 Antisense target rai1.S
Chr2S:1840988..1841012 21/25 Sense off-target LOC108709161
Chr1S:125295650..125295674 21/25 Antisense unknown
Chr9_10L:91726634..91726658 21/25 Sense unknown
Publications
First: Retinoic acid induced-1 (Rai1) regulates craniofacial and brain development in Xenopus., Mech Dev 2014                              
Most recent:
View All Papers