Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17328099

Morpholino Name: rai1 MO1
Synonyms:
Target mRNA: rai1

Morpholino Type: uncategorized morpholino
Sequence: 5' ACCTTTCCCGAAAAGACTGCATGGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genome
MO
5' GCCATGCAGTCTTTTCGGGAAAGGT 3'
   |||||||||||||||||||||||||
3' CGGTACGTCAGAAAAGCCCTTTCCA 5'
5' GTCATGCAGTCTTTTCGGGAAAGGT 3'
   | |||||||||||||||||||||||
3' CGGTACGTCAGAAAAGCCCTTTCCA 5'
5' GTCATGCAGTCTTTTCGGGAAAGGT 3'
   | |||||||||||||||||||||||
3' CGGTACGTCAGAAAAGCCCTTTCCA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:122541224..122541248 24/25 Antisense target rai1.L
Chr9_10S:106534021..106534045 24/25 Antisense target rai1.S
tropicalis 10.0 Chr9:15414344..15414368 25/25 Sense target rai1
Chr9:74782370..74782394 22/25 Sense unknown
Publications
First: Retinoic acid induced-1 (Rai1) regulates craniofacial and brain development in Xenopus., Mech Dev 2014                              
Most recent:
View All Papers