Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311460

Morpholino Name: rad51 MO1
Synonyms: TEgg126n13, XtRad51
Target mRNA: rad51

Morpholino Type: uncategorized morpholino
Sequence: 5' TCCTCTTCTGTGGCTTCTGCTTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 22/25
genome
MO
5' ATGAAGCAGAAGCCACAGAAGAGGA 3'
   |||||||||||||||||||||||||
3' TACTTCGTCTTCGGTGTCTTCTCCT 5'
5' ATCAAGCAGAAGCCACAGAAGAAGA 3'
   || ||||||||||||||||||| ||
3' TACTTCGTCTTCGGTGTCTTCTCCT 5'
5' ATGAAGCCGAAGCCACAGAGGAAGA 3'
   ||||||| ||||||||||| || ||
3' TACTTCGTCTTCGGTGTCTTCTCCT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:108283731..108283755 23/25 Antisense target rad51.L
Chr8S:89316006..89316030 22/25 Antisense target rad51.S
Chr3L:33747652..33747676 22/25 Antisense off-target diaph1.L
Chr2S:87892614..87892638 21/25 Sense off-target nxn.S
Chr3L:68773064..68773088 21/25 Antisense off-target nav3.L
Chr7L:106462580..106462604 21/25 Antisense off-target megf6.L
Chr7L:39911430..39911454 21/25 Antisense off-target pald1.L
Chr3L:15089852..15089876 21/25 Antisense off-target LOC121401383
Chr1S:72076910..72076934 21/25 Antisense off-target LOC108706776
Chr3S:17527408..17527432 21/25 Antisense off-target LOC121402115
Chr6L:69553019..69553043 21/25 Sense off-target LOC108719025
Chr1S:134943598..134943622 22/25 Antisense unknown
Chr2S:115081511..115081535 22/25 Antisense unknown
Chr7S:58143560..58143584 22/25 Antisense unknown
Chr3L:147981375..147981399 21/25 Antisense unknown
Chr1S:107969550..107969574 21/25 Sense unknown
Chr2L:119745306..119745330 21/25 Antisense unknown
Chr6S:27937575..27937599 21/25 Sense unknown
Chr3S:19375452..19375476 21/25 Antisense unknown
Chr3S:38066005..38066029 21/25 Antisense unknown
Chr5S:58495679..58495703 21/25 Sense unknown
Chr5S:79909300..79909324 21/25 Sense unknown
Chr8L:44971876..44971900 21/25 Sense unknown
Chr9_10L:89140246..89140270 21/25 Sense unknown
Chr9_10S:50750133..50750157 21/25 Sense unknown
Chr8S:7303723..7303747 21/25 Antisense unknown
tropicalis 10.0 Chr8:115029380..115029404 25/25 Antisense target rad51
Chr2:171334856..171334880 21/25 Antisense off-target dlg2
Chr6:139642011..139642035 21/25 Sense off-target zhx2
Chr6:144596723..144596747 21/25 Antisense unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers