Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311459

Morpholino Name: rac1 MO2
Synonyms: TEgg073l16, XtRac1
Target mRNA: rac1

Morpholino Type: uncategorized morpholino
Sequence: 5' GACCACACATTTAATGGCCTGCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 24/25
genome
MO
5' CATGCAGGCCATTAAATGTGTGGTC 3'
   |||||||||||||||||||||||||
3' GTACGTCCGGTAATTTACACACCAG 5'
5' CATGCAGGCCATTAAATGTGTGGTG 3'
   |||||||||||||||||||||||| 
3' GTACGTCCGGTAATTTACACACCAG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:110940118..110940142 24/25 Sense target rac1.L
Chr9_10S:96784879..96784903 24/25 Sense off-target rac3.S
Chr7L:98342293..98342317 22/25 Sense off-target cdc42.L
Chr7S:82590439..82590463 22/25 Sense off-target cdc42.S
Chr4L:121304387..121304411 21/25 Antisense off-target rac2.L
Chr4S:102314506..102314530 21/25 Antisense off-target LOC108715797
Chr2L:76259944..76259968 21/25 Sense unknown
tropicalis 10.0 Chr9:25458710..25458734 25/25 Antisense target rac1
Chr4:123075304..123075328 22/25 Antisense off-target rac2
Chr7:94430335..94430359 22/25 Sense off-target cdc42
Chr10:31667836..31667860 21/25 Antisense off-target rac3
Chr2:47585142..47585166 21/25 Sense off-target sgsm2
Chr1:75376633..75376657 22/25 Antisense unknown
Chr10:36841614..36841638 21/25 Antisense unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers