Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311420

Morpholino Name: ubn2 MO2
Synonyms: TEgg140p11, Xtnovel47.2
Target mRNA: ubn2

Morpholino Type: uncategorized morpholino
Sequence: 5' ACTCACACACACAGTCTCTCACAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' GCTGTGAGAGACTGTGTGTGTGAGT 3'
   |||||||||||||||||||||||||
3' CGACACTCTCTGACACACACACTCA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:11289087..11289111 23/25 Antisense off-target iqsec2.L
Chr9_10L:133340271..133340295 23/25 Sense off-target LOC108703739
Chr1L:91288602..91288626 22/25 Antisense off-target aff1.L
Chr2L:159321395..159321419 22/25 Antisense off-target cog6.L
Chr3L:148595466..148595490 22/25 Sense off-target kank2.L
Chr8S:14144821..14144845 22/25 Antisense off-target fermt2.S
Chr7L:102860493..102860517 22/25 Antisense off-target nphp4.2.L
Chr1S:200817861..200817885 22/25 Antisense off-target LOC108704986
Chr1S:98969196..98969220 22/25 Antisense off-target palm2akap2.S
Chr4L:9516439..9516463 22/25 Sense off-target LOC121402923
Chr4S:103178466..103178490 22/25 Sense off-target LOC108715807
Chr5S:27926730..27926754 22/25 Sense off-target LOC121394169
Chr6L:127887194..127887218 22/25 Antisense off-target LOC108719287
Chr9_10S:16359989..16360013 22/25 Antisense off-target LOC108705690
Chr9_10S:17178380..17178404 22/25 Antisense off-target LOC121398750
Chr9_10S:17219773..17219797 22/25 Antisense off-target LOC121398751
Chr9_10S:36978396..36978420 22/25 Antisense off-target LOC108702770
Chr6L:162553945..162553969 21/25 Sense off-target gpt.L
Chr6L:162554109..162554133 21/25 Sense off-target gpt.L
Chr6L:162758910..162758934 21/25 Sense off-target scx.L
Chr6L:162553678..162553702 21/25 Sense off-target gpt.L
Chr6L:162553816..162553840 21/25 Sense off-target gpt.L
Chr1S:191634832..191634856 21/25 Antisense off-target mbd2.S
Chr1S:193445516..193445540 21/25 Antisense off-target ctif.S
Chr3L:1318119..1318143 21/25 Sense off-target sox5.L
Chr3L:1318263..1318287 21/25 Sense off-target sox5.L
Chr3S:131723879..131723903 21/25 Sense off-target ybx2.S
Chr6L:162758910..162758934 21/25 Sense off-target bop1.L
Chr6S:136499170..136499194 21/25 Antisense off-target plec.S
Chr7L:41814639..41814663 21/25 Sense off-target gbf1.L
Chr7L:41814715..41814739 21/25 Sense off-target gbf1.L
Chr7L:41814739..41814763 21/25 Sense off-target gbf1.L
Chr8L:14333191..14333215 21/25 Antisense off-target plp2.L
Chr8L:72107606..72107630 21/25 Sense off-target pak4.L
Chr1L:193670717..193670741 21/25 Antisense off-target nr2f1.L
Chr1L:193670763..193670787 21/25 Antisense off-target nr2f1.L
Chr1L:193670799..193670823 21/25 Antisense off-target nr2f1.L
Chr1L:193670857..193670881 21/25 Antisense off-target nr2f1.L
Chr1L:193670897..193670921 21/25 Antisense off-target nr2f1.L
Chr1L:193670943..193670967 21/25 Antisense off-target nr2f1.L
Chr2L:1355613..1355637 21/25 Antisense off-target gsk3b.L
Chr2L:110045169..110045193 21/25 Sense off-target egfl6.L
Chr3L:148595154..148595178 21/25 Sense off-target kank2.L
Chr4L:130855395..130855419 21/25 Antisense off-target rad18.L
Chr5L:1070359..1070383 21/25 Sense off-target plcb4.L
Chr5L:1071303..1071327 21/25 Sense off-target plcb4.L
Chr5S:26620818..26620842 21/25 Sense off-target plcb1.S
Chr5S:6153322..6153346 21/25 Sense off-target ttbk1.S
Chr5S:7474725..7474749 21/25 Antisense off-target btbd9.S
Chr5S:7474767..7474791 21/25 Antisense off-target btbd9.S
Chr5S:7474817..7474841 21/25 Antisense off-target btbd9.S
Chr6L:17161244..17161268 21/25 Antisense off-target esyt2.L
Chr6L:17161274..17161298 21/25 Antisense off-target esyt2.L
Chr6L:41680064..41680088 21/25 Antisense off-target pals2.L
Chr6L:41680232..41680256 21/25 Antisense off-target pals2.L
Chr6S:3362056..3362080 21/25 Antisense off-target dhx30.S
Chr6S:3362078..3362102 21/25 Antisense off-target dhx30.S
Chr6S:9082472..9082496 21/25 Antisense off-target kmt2c.S
Chr4L:111416963..111416987 21/25 Sense off-target grin2b.L
Chr4L:38693468..38693492 21/25 Antisense off-target znf423.L
Chr4S:113672469..113672493 21/25 Sense off-target chchd6.S
Chr6S:97684183..97684207 21/25 Antisense off-target garem1.S
Chr6S:97684301..97684325 21/25 Antisense off-target garem1.S
Chr6S:97684523..97684547 21/25 Antisense off-target garem1.S
Chr6S:97684881..97684905 21/25 Antisense off-target garem1.S
Chr6S:97685155..97685179 21/25 Antisense off-target garem1.S
Chr6S:97685171..97685195 21/25 Antisense off-target garem1.S
Chr6S:97685187..97685211 21/25 Antisense off-target garem1.S
Chr6S:97685279..97685303 21/25 Antisense off-target garem1.S
Chr6S:97685337..97685361 21/25 Antisense off-target garem1.S
Chr6S:97685381..97685405 21/25 Antisense off-target garem1.S
Chr7L:61326041..61326065 21/25 Antisense off-target zdhhc5.L
Chr7S:12104898..12104922 21/25 Sense off-target stk32c.S
Chr8L:120215970..120215994 21/25 Antisense off-target anp32e.L
Chr8L:120215986..120216010 21/25 Antisense off-target anp32e.L
Chr8L:120216302..120216326 21/25 Antisense off-target anp32e.L
Chr8L:120216456..120216480 21/25 Antisense off-target anp32e.L
Chr8L:120216476..120216500 21/25 Antisense off-target anp32e.L
Chr8L:25495545..25495569 21/25 Antisense off-target gabra3.L
Chr8S:54926296..54926320 21/25 Antisense off-target nexmif.S
Chr9_10S:785004..785028 21/25 Antisense off-target dnajc7.S
Chr2L:167451301..167451325 21/25 Antisense off-target zdhhc20.L
Chr2L:167451615..167451639 21/25 Antisense off-target zdhhc20.L
Chr2L:167451633..167451657 21/25 Antisense off-target zdhhc20.L
Chr2L:167451651..167451675 21/25 Antisense off-target zdhhc20.L
Chr2S:8850763..8850787 21/25 Antisense off-target st3gal6.S
Chr2S:8850809..8850833 21/25 Antisense off-target st3gal6.S
Chr6L:157619257..157619281 21/25 Antisense off-target trappc9.L
Chr8S:103074801..103074825 21/25 Sense off-target pip5k1a.S
Chr3L:138221071..138221095 21/25 Antisense off-target slc39a14.L
Chr4L:151852165..151852189 21/25 Antisense off-target cacna2d3.L
Chr4L:151913213..151913237 21/25 Sense off-target cacna2d3.L
Chr6L:148845072..148845096 21/25 Sense off-target trpv4l.1.L
Chr6L:148845270..148845294 21/25 Sense off-target trpv4l.1.L
Chr1L:195218159..195218183 21/25 Antisense off-target LOC121395339
Chr1L:233553644..233553668 21/25 Antisense off-target LOC108719266
Chr2L:11798410..11798434 21/25 Antisense off-target LOC108707858
Chr3L:12199587..12199611 21/25 Antisense off-target LOC121400994
Chr2L:184754815..184754839 21/25 Sense off-target LOC108707637
Chr2L:184755387..184755411 21/25 Sense off-target LOC108707637
Chr2L:184755849..184755873 21/25 Sense off-target LOC108707637
Chr2L:184756833..184756857 21/25 Sense off-target LOC108707637
Chr2L:184756849..184756873 21/25 Sense off-target LOC108707637
Chr3L:10848221..10848245 21/25 Antisense off-target LOC121393056
Chr3L:12959044..12959068 21/25 Antisense off-target LOC121400994
Chr3L:12255137..12255161 21/25 Sense off-target LOC121400994
Chr3L:1898398..1898422 21/25 Antisense off-target LOC108710178
Chr3L:1898542..1898566 21/25 Antisense off-target LOC108710178
Chr3L:97656259..97656283 21/25 Sense off-target LOC108711293
Chr3S:14154086..14154110 21/25 Sense off-target LOC108712625
Chr3S:14151692..14151716 21/25 Sense off-target LOC108712625
Chr3S:14151826..14151850 21/25 Sense off-target LOC108712625
Chr3S:14151999..14152023 21/25 Sense off-target LOC108712625
Chr4L:154981022..154981046 21/25 Sense off-target LOC108705353
Chr4L:154981070..154981094 21/25 Sense off-target LOC108705353
Chr4S:103180970..103180994 21/25 Sense off-target LOC108715807
Chr4S:103181412..103181436 21/25 Sense off-target LOC108715807
Chr4S:103180144..103180168 21/25 Sense off-target LOC108715807
Chr4S:103180582..103180606 21/25 Sense off-target LOC108715807
Chr4S:7923570..7923594 21/25 Sense off-target LOC108715206
Chr4S:7923800..7923824 21/25 Sense off-target LOC108715206
Chr6L:1004466..1004490 21/25 Sense off-target LOC108704616
Chr6L:14092337..14092361 21/25 Sense off-target LOC108718466
Chr6L:1428317..1428341 21/25 Sense off-target LOC121394516
Chr6S:104922914..104922938 21/25 Sense off-target LOC108695329
Chr6S:104922926..104922950 21/25 Sense off-target LOC108695329
Chr6S:741469..741493 21/25 Antisense off-target LOC121395196
Chr6S:741469..741493 21/25 Antisense off-target LOC108719641
Chr6S:104923097..104923121 21/25 Sense off-target LOC108695329
Chr6S:104923113..104923137 21/25 Sense off-target LOC108695329
Chr6S:104923316..104923340 21/25 Sense off-target LOC108695329
Chr7L:135776246..135776270 21/25 Antisense off-target LOC108696863
Chr7S:20747225..20747249 21/25 Antisense off-target LOC121396214
Chr7S:43783262..43783286 21/25 Antisense off-target LOC108703378
Chr8L:127675003..127675027 21/25 Antisense off-target LOC121397224
Chr8L:127675003..127675027 21/25 Antisense off-target LOC121397222
Chr8L:127675003..127675027 21/25 Antisense off-target LOC121397226
Chr8L:129181937..129181961 21/25 Antisense off-target LOC108705811
Chr8L:134746234..134746258 21/25 Sense off-target LOC108699599
Chr9_10L:5588806..5588830 21/25 Sense off-target LOC108700843
Chr9_10S:17254194..17254218 21/25 Antisense off-target LOC108705600
Chr9_10S:1990099..1990123 21/25 Sense off-target LOC108702492
Chr8L:11859876..11859900 23/25 Sense unknown
Chr1L:109105838..109105862 22/25 Sense unknown
Chr1L:136682798..136682822 22/25 Antisense unknown
Chr1L:165966573..165966597 22/25 Sense unknown
Chr1L:99031735..99031759 22/25 Antisense unknown
Chr2L:14435291..14435315 22/25 Antisense unknown
Chr2L:179418986..179419010 22/25 Sense unknown
Chr2L:80300371..80300395 22/25 Sense unknown
Chr2S:78428154..78428178 22/25 Antisense unknown
Chr4L:9034820..9034844 22/25 Sense unknown
Chr4L:9070223..9070247 22/25 Sense unknown
Chr4L:9092318..9092342 22/25 Sense unknown
Chr4L:9126791..9126815 22/25 Sense unknown
Chr4L:9158707..9158731 22/25 Sense unknown
Chr4L:9163342..9163366 22/25 Sense unknown
Chr4L:9188103..9188127 22/25 Sense unknown
Chr4L:9203682..9203706 22/25 Sense unknown
Chr4L:9325001..9325025 22/25 Sense unknown
Chr4L:9383394..9383418 22/25 Sense unknown
Chr4L:9400942..9400966 22/25 Sense unknown
Chr4L:9425315..9425339 22/25 Sense unknown
Chr4L:9429952..9429976 22/25 Sense unknown
Chr4L:9454348..9454372 22/25 Sense unknown
Chr4L:9459123..9459147 22/25 Sense unknown
Chr4L:9482284..9482308 22/25 Sense unknown
Chr4L:9501286..9501310 22/25 Sense unknown
Chr5L:141174313..141174337 22/25 Sense unknown
Chr5S:91897566..91897590 22/25 Antisense unknown
Chr6L:154946564..154946588 22/25 Antisense unknown
Chr6L:160730888..160730912 22/25 Antisense unknown
Chr6S:42604096..42604120 22/25 Sense unknown
Chr7L:138241163..138241187 22/25 Sense unknown
Chr7L:45887729..45887753 22/25 Antisense unknown
Chr7L:54543120..54543144 22/25 Antisense unknown
Chr7S:15864111..15864135 22/25 Antisense unknown
Chr7S:8764447..8764471 22/25 Sense unknown
Chr7S:8769735..8769759 22/25 Sense unknown
Chr7S:8778975..8778999 22/25 Sense unknown
Chr8L:49423185..49423209 22/25 Sense unknown
Chr9_10L:43302337..43302361 22/25 Sense unknown
Chr1L:135426864..135426888 21/25 Sense unknown
Chr1L:233016916..233016940 21/25 Sense unknown
Chr1L:24260748..24260772 21/25 Antisense unknown
Chr1L:811886..811910 21/25 Antisense unknown
Chr1L:84746695..84746719 21/25 Sense unknown
Chr1L:24261116..24261140 21/25 Antisense unknown
Chr1S:3493817..3493841 21/25 Antisense unknown
Chr1S:63218616..63218640 21/25 Sense unknown
Chr1S:63219174..63219198 21/25 Sense unknown
Chr1S:3493729..3493753 21/25 Antisense unknown
Chr1S:63219804..63219828 21/25 Sense unknown
Chr2L:1147620..1147644 21/25 Sense unknown
Chr2L:1148369..1148393 21/25 Sense unknown
Chr3L:11298783..11298807 21/25 Sense unknown
Chr2L:186590784..186590808 21/25 Antisense unknown
Chr2L:32018888..32018912 21/25 Sense unknown
Chr2L:39408097..39408121 21/25 Sense unknown
Chr2L:71004766..71004790 21/25 Sense unknown
Chr2S:62448756..62448780 21/25 Antisense unknown
Chr3L:105106593..105106617 21/25 Antisense unknown
Chr3L:105106899..105106923 21/25 Antisense unknown
Chr3L:105106925..105106949 21/25 Antisense unknown
Chr3L:123734992..123735016 21/25 Antisense unknown
Chr3L:6395226..6395250 21/25 Antisense unknown
Chr3S:52136228..52136252 21/25 Sense unknown
Chr3L:97656315..97656339 21/25 Sense unknown
Chr4L:40217161..40217185 21/25 Antisense unknown
Chr4L:55984975..55984999 21/25 Sense unknown
Chr4L:55985649..55985673 21/25 Sense unknown
Chr4S:130063944..130063968 21/25 Sense unknown
Chr4S:131597927..131597951 21/25 Sense unknown
Chr4S:13938354..13938378 21/25 Antisense unknown
Chr4S:29194036..29194060 21/25 Antisense unknown
Chr4S:7529710..7529734 21/25 Sense unknown
Chr5L:141170666..141170690 21/25 Sense unknown
Chr5L:148149966..148149990 21/25 Antisense unknown
Chr5L:18173951..18173975 21/25 Sense unknown
Chr5L:18174185..18174209 21/25 Sense unknown
Chr5L:18174281..18174305 21/25 Sense unknown
Chr5L:55362429..55362453 21/25 Sense unknown
Chr5S:103478458..103478482 21/25 Sense unknown
Chr5S:103479362..103479386 21/25 Sense unknown
Chr5S:103479612..103479636 21/25 Sense unknown
Chr5S:115779624..115779648 21/25 Antisense unknown
Chr5S:119352983..119353007 21/25 Antisense unknown
Chr5S:103479454..103479478 21/25 Sense unknown
Chr5S:63415623..63415647 21/25 Sense unknown
Chr5S:72516373..72516397 21/25 Sense unknown
Chr5S:75143373..75143397 21/25 Sense unknown
Chr5S:91897654..91897678 21/25 Antisense unknown
Chr5S:91897670..91897694 21/25 Antisense unknown
Chr6L:130562335..130562359 21/25 Antisense unknown
Chr6L:40024271..40024295 21/25 Antisense unknown
Chr6L:96875082..96875106 21/25 Sense unknown
Chr6L:160731124..160731148 21/25 Antisense unknown
Chr6S:105931124..105931148 21/25 Sense unknown
Chr6S:14611077..14611101 21/25 Sense unknown
Chr6S:36866213..36866237 21/25 Antisense unknown
Chr6S:36866425..36866449 21/25 Antisense unknown
Chr6S:105930869..105930893 21/25 Sense unknown
Chr6S:105930929..105930953 21/25 Sense unknown
Chr7L:113957740..113957764 21/25 Antisense unknown
Chr7L:136886671..136886695 21/25 Antisense unknown
Chr7L:138241245..138241269 21/25 Sense unknown
Chr7L:138241275..138241299 21/25 Sense unknown
Chr7L:138241373..138241397 21/25 Sense unknown
Chr7L:43559330..43559354 21/25 Antisense unknown
Chr7L:69240403..69240427 21/25 Antisense unknown
Chr7L:76529203..76529227 21/25 Antisense unknown
Chr7L:76535314..76535338 21/25 Antisense unknown
Chr7S:18515839..18515863 21/25 Sense unknown
Chr7S:34861479..34861503 21/25 Antisense unknown
Chr7S:70079580..70079604 21/25 Antisense unknown
Chr7S:92314033..92314057 21/25 Antisense unknown
Chr7S:97545648..97545672 21/25 Antisense unknown
Chr8L:129192103..129192127 21/25 Antisense unknown
Chr8L:129192209..129192233 21/25 Antisense unknown
Chr8L:129192275..129192299 21/25 Antisense unknown
Chr8L:129192365..129192389 21/25 Antisense unknown
Chr8L:129192421..129192445 21/25 Antisense unknown
Chr8L:130698538..130698562 21/25 Antisense unknown
Chr8L:130847639..130847663 21/25 Sense unknown
Chr8L:133853505..133853529 21/25 Antisense unknown
Chr8L:134655112..134655136 21/25 Antisense unknown
Chr8L:38249838..38249862 21/25 Antisense unknown
Chr8L:38249854..38249878 21/25 Antisense unknown
Chr8L:38249902..38249926 21/25 Antisense unknown
Chr8L:38249918..38249942 21/25 Antisense unknown
Chr8L:38249966..38249990 21/25 Antisense unknown
Chr8L:55779912..55779936 21/25 Antisense unknown
Chr8S:1058897..1058921 21/25 Sense unknown
Chr8S:58385873..58385897 21/25 Antisense unknown
Chr9_10L:13306808..13306832 21/25 Antisense unknown
Chr9_10L:16248686..16248710 21/25 Antisense unknown
Chr9_10L:45450596..45450620 21/25 Antisense unknown
Chr9_10L:53146995..53147019 21/25 Antisense unknown
Chr9_10S:10385741..10385765 21/25 Sense unknown
Chr9_10S:117230938..117230962 21/25 Sense unknown
Chr9_10S:117230986..117231010 21/25 Sense unknown
Chr9_10S:21421432..21421456 21/25 Antisense unknown
Chr9_10S:28668384..28668408 21/25 Sense unknown
Chr9_10S:36313637..36313661 21/25 Sense unknown
Chr9_10S:36346009..36346033 21/25 Sense unknown
Chr9_10S:48684182..48684206 21/25 Antisense unknown
tropicalis 10.0 Chr4:114757509..114757533 25/25 Antisense target ubn2
Chr4:114757509..114757533 25/25 Antisense off-target gucy2c
Chr4:151142172..151142196 22/25 Sense off-target syn2
Chr4:151142172..151142196 22/25 Sense off-target timp4
Chr6:7546834..7546858 22/25 Antisense off-target plcd1
Chr8:1630002..1630026 22/25 Sense off-target grin1
Chr1:65789882..65789906 22/25 Sense off-target spata5
Chr2:1467486..1467510 22/25 Sense off-target icoslg
Chr4:66775083..66775107 22/25 Sense off-target zc3h18
Chr4:66775109..66775133 22/25 Sense off-target zc3h18
Chr4:66775131..66775155 22/25 Sense off-target zc3h18
Chr4:66775151..66775175 22/25 Sense off-target zc3h18
Chr4:66775173..66775197 22/25 Sense off-target zc3h18
Chr4:66775193..66775217 22/25 Sense off-target zc3h18
Chr4:66775213..66775237 22/25 Sense off-target zc3h18
Chr4:66775233..66775257 22/25 Sense off-target zc3h18
Chr4:66775253..66775277 22/25 Sense off-target zc3h18
Chr4:66775291..66775315 22/25 Sense off-target zc3h18
Chr4:66775313..66775337 22/25 Sense off-target zc3h18
Chr4:66775333..66775357 22/25 Sense off-target zc3h18
Chr4:66775401..66775425 22/25 Sense off-target zc3h18
Chr4:66775439..66775463 22/25 Sense off-target zc3h18
Chr4:66775459..66775483 22/25 Sense off-target zc3h18
Chr4:66775559..66775583 22/25 Sense off-target zc3h18
Chr4:66775583..66775607 22/25 Sense off-target zc3h18
Chr4:66775635..66775659 22/25 Sense off-target zc3h18
Chr4:66775683..66775707 22/25 Sense off-target zc3h18
Chr4:66775729..66775753 22/25 Sense off-target zc3h18
Chr4:66775749..66775773 22/25 Sense off-target zc3h18
Chr4:66775773..66775797 22/25 Sense off-target zc3h18
Chr4:66775797..66775821 22/25 Sense off-target zc3h18
Chr4:66775827..66775851 22/25 Sense off-target zc3h18
Chr4:66775847..66775871 22/25 Sense off-target zc3h18
Chr4:66775867..66775891 22/25 Sense off-target zc3h18
Chr4:66775887..66775911 22/25 Sense off-target zc3h18
Chr4:66775913..66775937 22/25 Sense off-target zc3h18
Chr4:66775958..66775982 22/25 Sense off-target zc3h18
Chr8:70091727..70091751 22/25 Sense off-target atp11c
Chr10:41357532..41357556 21/25 Sense off-target raly
Chr3:404244..404268 21/25 Antisense off-target lmo3
Chr3:404492..404516 21/25 Antisense off-target lmo3
Chr4:709941..709965 21/25 Sense off-target otog
Chr7:6352466..6352490 21/25 Sense off-target bag3
Chr10:34791044..34791068 21/25 Antisense off-target tshz2
Chr2:135821081..135821105 21/25 Antisense off-target adcy6
Chr2:135821095..135821119 21/25 Antisense off-target adcy6
Chr3:3548872..3548896 21/25 Sense off-target wnt7b
Chr3:3549030..3549054 21/25 Sense off-target wnt7b
Chr3:3549166..3549190 21/25 Sense off-target wnt7b
Chr3:3549222..3549246 21/25 Sense off-target wnt7b
Chr3:3549344..3549368 21/25 Sense off-target wnt7b
Chr3:3549374..3549398 21/25 Sense off-target wnt7b
Chr3:3549898..3549922 21/25 Sense off-target wnt7b
Chr3:3549926..3549950 21/25 Sense off-target wnt7b
Chr3:3550098..3550122 21/25 Sense off-target wnt7b
Chr4:129783061..129783085 21/25 Sense off-target cntn4
Chr4:153120815..153120839 21/25 Sense off-target nisch
Chr4:153120839..153120863 21/25 Sense off-target nisch
Chr4:153121151..153121175 21/25 Sense off-target nisch
Chr4:153121191..153121215 21/25 Sense off-target nisch
Chr4:153121215..153121239 21/25 Sense off-target nisch
Chr4:153121533..153121557 21/25 Sense off-target nisch
Chr4:153121595..153121619 21/25 Sense off-target nisch
Chr4:153121927..153121951 21/25 Sense off-target nisch
Chr4:153121953..153121977 21/25 Sense off-target nisch
Chr4:153121979..153122003 21/25 Sense off-target nisch
Chr4:376299..376323 21/25 Sense off-target ptpn5
Chr4:376453..376477 21/25 Sense off-target ptpn5
Chr5:1261697..1261721 21/25 Antisense off-target epha8
Chr5:1261713..1261737 21/25 Antisense off-target epha8
Chr5:1262047..1262071 21/25 Antisense off-target epha8
Chr5:1262345..1262369 21/25 Antisense off-target epha8
Chr6:142190732..142190756 21/25 Sense off-target asap1
Chr6:142190796..142190820 21/25 Sense off-target asap1
Chr6:142190894..142190918 21/25 Sense off-target asap1
Chr6:142190992..142191016 21/25 Sense off-target asap1
Chr6:142191048..142191072 21/25 Sense off-target asap1
Chr6:142192108..142192132 21/25 Sense off-target asap1
Chr6:142192172..142192196 21/25 Sense off-target asap1
Chr6:142192332..142192356 21/25 Sense off-target asap1
Chr6:142192428..142192452 21/25 Sense off-target asap1
Chr6:142192534..142192558 21/25 Sense off-target asap1
Chr6:142192602..142192626 21/25 Sense off-target asap1
Chr6:44085236..44085260 21/25 Antisense off-target rftn1
Chr6:7356737..7356761 21/25 Antisense off-target myd88
Chr6:7357079..7357103 21/25 Antisense off-target myd88
Chr6:7357159..7357183 21/25 Antisense off-target myd88
Chr6:7357231..7357255 21/25 Antisense off-target myd88
Chr6:7357293..7357317 21/25 Antisense off-target myd88
Chr6:7357363..7357387 21/25 Antisense off-target myd88
Chr6:7357495..7357519 21/25 Antisense off-target myd88
Chr6:7357569..7357593 21/25 Antisense off-target myd88
Chr7:129969838..129969862 21/25 Sense off-target capzb
Chr7:129971626..129971650 21/25 Sense off-target capzb
Chr7:129971908..129971932 21/25 Sense off-target capzb
Chr7:129971934..129971958 21/25 Sense off-target capzb
Chr9:214532..214556 21/25 Antisense off-target mgrn1
Chr9:215500..215524 21/25 Antisense off-target mgrn1
Chr9:215732..215756 21/25 Antisense off-target mgrn1
Chr9:216196..216220 21/25 Antisense off-target mgrn1
Chr9:65099998..65100022 21/25 Antisense off-target hoxd3
Chr9:65100136..65100160 21/25 Antisense off-target hoxd3
Chr9:65100220..65100244 21/25 Antisense off-target hoxd3
Chr9:65100328..65100352 21/25 Antisense off-target hoxd3
Chr1:65789306..65789330 21/25 Sense off-target spata5
Chr1:65789676..65789700 21/25 Sense off-target spata5
Chr1:65789696..65789720 21/25 Sense off-target spata5
Chr1:65789716..65789740 21/25 Sense off-target spata5
Chr1:65789782..65789806 21/25 Sense off-target spata5
Chr1:65789802..65789826 21/25 Sense off-target spata5
Chr10:50859380..50859404 21/25 Antisense off-target cep112
Chr10:50859420..50859444 21/25 Antisense off-target cep112
Chr10:50859504..50859528 21/25 Antisense off-target cep112
Chr10:50859584..50859608 21/25 Antisense off-target cep112
Chr10:50859654..50859678 21/25 Antisense off-target cep112
Chr10:50859670..50859694 21/25 Antisense off-target cep112
Chr10:50859686..50859710 21/25 Antisense off-target cep112
Chr10:50859702..50859726 21/25 Antisense off-target cep112
Chr2:125810..125834 21/25 Sense off-target recql4
Chr2:125856..125880 21/25 Sense off-target recql4
Chr4:114225458..114225482 21/25 Antisense off-target grin2b
Chr4:66774983..66775007 21/25 Sense off-target zc3h18
Chr4:66775007..66775031 21/25 Sense off-target zc3h18
Chr4:66775031..66775055 21/25 Sense off-target zc3h18
Chr4:66775055..66775079 21/25 Sense off-target zc3h18
Chr4:66775365..66775389 21/25 Sense off-target zc3h18
Chr4:66775383..66775407 21/25 Sense off-target zc3h18
Chr4:66775419..66775443 21/25 Sense off-target zc3h18
Chr4:66775481..66775505 21/25 Sense off-target zc3h18
Chr4:66775605..66775629 21/25 Sense off-target zc3h18
Chr4:66775649..66775673 21/25 Sense off-target zc3h18
Chr4:66775663..66775687 21/25 Sense off-target zc3h18
Chr4:66775703..66775727 21/25 Sense off-target zc3h18
Chr4:66775994..66776018 21/25 Sense off-target zc3h18
Chr4:66776078..66776102 21/25 Sense off-target zc3h18
Chr4:66776092..66776116 21/25 Sense off-target zc3h18
Chr4:66776316..66776340 21/25 Sense off-target zc3h18
Chr4:66776332..66776356 21/25 Sense off-target zc3h18
Chr6:1014564..1014588 21/25 Sense off-target slc4a2
Chr6:1015289..1015313 21/25 Sense off-target slc4a2
Chr6:1015315..1015339 21/25 Sense off-target slc4a2
Chr6:1015463..1015487 21/25 Sense off-target slc4a2
Chr6:28264732..28264756 21/25 Antisense off-target cacnb2
Chr6:28264822..28264846 21/25 Antisense off-target cacnb2
Chr7:112986506..112986530 21/25 Antisense off-target pih1d1
Chr9:620965..620989 21/25 Sense off-target atp2a1
Chr2:6769686..6769710 21/25 Antisense off-target tmem39a
Chr2:6769702..6769726 21/25 Antisense off-target tmem39a
Chr2:6769782..6769806 21/25 Antisense off-target tmem39a
Chr2:6769798..6769822 21/25 Antisense off-target tmem39a
Chr7:106744793..106744817 21/25 Antisense off-target arhgef1
Chr7:6060459..6060483 21/25 Sense off-target fam204a
Chr7:6060569..6060593 21/25 Sense off-target fam204a
Chr1:179743152..179743176 21/25 Sense off-target tmem161b
Chr6:153380197..153380221 21/25 Sense off-target arhgap39
Chr6:153388389..153388413 21/25 Antisense off-target arhgap39
Chr6:153388453..153388477 21/25 Antisense off-target arhgap39
Chr6:153388595..153388619 21/25 Antisense off-target arhgap39
Chr6:153388623..153388647 21/25 Antisense off-target arhgap39
Chr5:14987937..14987961 21/25 Antisense off-target LOC733493
Chr10:6228315..6228339 21/25 Sense off-target LOC101732252
Chr10:6228351..6228375 21/25 Sense off-target LOC101732252
Chr10:6228381..6228405 21/25 Sense off-target LOC101732252
Chr10:6228417..6228441 21/25 Sense off-target LOC101732252
Chr10:6228439..6228463 21/25 Sense off-target LOC101732252
Chr10:6228475..6228499 21/25 Sense off-target LOC101732252
Chr4:126398088..126398112 21/25 Sense off-target LOC100496572
Chr7:7793375..7793399 21/25 Sense off-target LOC100491523
Chr8:10890303..10890327 21/25 Sense off-target LOC116406899
Chr8:10890319..10890343 21/25 Sense off-target LOC116406899
Chr8:10890521..10890545 21/25 Sense off-target LOC116406899
Chr8:10890537..10890561 21/25 Sense off-target LOC116406899
Chr8:10890553..10890577 21/25 Sense off-target LOC116406899
Chr8:10890587..10890611 21/25 Sense off-target LOC116406899
Chr8:570732..570756 21/25 Sense off-target LOC116406888
Chr9:1704246..1704270 21/25 Antisense off-target LOC100496344
Chr9:90441678..90441702 21/25 Sense off-target LOC116407839
Chr9:90446326..90446350 21/25 Sense off-target LOC116407839
Chr9:90447306..90447330 21/25 Sense off-target LOC116407839
Chr9:90447420..90447444 21/25 Sense off-target LOC116407839
Chr9:90447920..90447944 21/25 Sense off-target LOC116407839
Chr9:90447998..90448022 21/25 Sense off-target LOC116407839
Chr9:90448189..90448213 21/25 Sense off-target LOC116407839
Chr9:90449483..90449507 21/25 Sense off-target LOC116407839
Chr10:34791772..34791796 22/25 Antisense unknown
Chr5:4535..4559 22/25 Antisense unknown
Chr1:178159814..178159838 21/25 Antisense unknown
Chr1:217138464..217138488 21/25 Sense unknown
Chr10:10995167..10995191 21/25 Sense unknown
Chr10:34791152..34791176 21/25 Antisense unknown
Chr10:34791368..34791392 21/25 Antisense unknown
Chr10:34791826..34791850 21/25 Antisense unknown
Chr10:6228049..6228073 21/25 Sense unknown
Chr10:6228129..6228153 21/25 Sense unknown
Chr10:6228161..6228185 21/25 Sense unknown
Chr10:6228187..6228211 21/25 Sense unknown
Chr10:6228223..6228247 21/25 Sense unknown
Chr10:6228245..6228269 21/25 Sense unknown
Chr2:132031689..132031713 21/25 Antisense unknown
Chr2:151378679..151378703 21/25 Sense unknown
Chr2:180110515..180110539 21/25 Sense unknown
Chr2:180110735..180110759 21/25 Sense unknown
Chr2:180111002..180111026 21/25 Sense unknown
Chr2:25711064..25711088 21/25 Sense unknown
Chr2:440921..440945 21/25 Antisense unknown
Chr2:440945..440969 21/25 Antisense unknown
Chr2:440989..441013 21/25 Antisense unknown
Chr2:441013..441037 21/25 Antisense unknown
Chr3:151715348..151715372 21/25 Sense unknown
Chr3:339192..339216 21/25 Antisense unknown
Chr3:5806456..5806480 21/25 Sense unknown
Chr3:5806532..5806556 21/25 Sense unknown
Chr3:5806590..5806614 21/25 Sense unknown
Chr3:5806612..5806636 21/25 Sense unknown
Chr3:5806638..5806662 21/25 Sense unknown
Chr3:5806660..5806684 21/25 Sense unknown
Chr3:5806742..5806766 21/25 Sense unknown
Chr3:5806878..5806902 21/25 Sense unknown
Chr4:152944682..152944706 21/25 Sense unknown
Chr4:152944970..152944994 21/25 Sense unknown
Chr4:152945018..152945042 21/25 Sense unknown
Chr4:152945416..152945440 21/25 Sense unknown
Chr4:152945432..152945456 21/25 Sense unknown
Chr4:152945480..152945504 21/25 Sense unknown
Chr4:152945496..152945520 21/25 Sense unknown
Chr5:162008072..162008096 21/25 Sense unknown
Chr5:162008088..162008112 21/25 Sense unknown
Chr5:162008116..162008140 21/25 Sense unknown
Chr5:162008312..162008336 21/25 Sense unknown
Chr5:4601..4625 21/25 Antisense unknown
Chr6:104146294..104146318 21/25 Antisense unknown
Chr6:104146470..104146494 21/25 Antisense unknown
Chr6:113567806..113567830 21/25 Sense unknown
Chr6:113567830..113567854 21/25 Sense unknown
Chr6:113567996..113568020 21/25 Sense unknown
Chr6:113568084..113568108 21/25 Sense unknown
Chr6:113568124..113568148 21/25 Sense unknown
Chr6:113568216..113568240 21/25 Sense unknown
Chr6:113568254..113568278 21/25 Sense unknown
Chr6:113568294..113568318 21/25 Sense unknown
Chr6:11584298..11584322 21/25 Sense unknown
Chr6:120298117..120298141 21/25 Sense unknown
Chr6:120299451..120299475 21/25 Sense unknown
Chr6:120299483..120299507 21/25 Sense unknown
Chr6:1214158..1214182 21/25 Sense unknown
Chr6:28265110..28265134 21/25 Antisense unknown
Chr6:28265294..28265318 21/25 Antisense unknown
Chr6:44084904..44084928 21/25 Antisense unknown
Chr6:44085080..44085104 21/25 Antisense unknown
Chr7:1329598..1329622 21/25 Sense unknown
Chr7:2315647..2315671 21/25 Antisense unknown
Chr8:134702179..134702203 21/25 Antisense unknown
Chr8:3447128..3447152 21/25 Antisense unknown
Chr9:67437257..67437281 21/25 Sense unknown
Chr9:67437529..67437553 21/25 Sense unknown
Chr9:7952161..7952185 21/25 Antisense unknown
Chr9:7952231..7952255 21/25 Antisense unknown
Chr9:7952385..7952409 21/25 Antisense unknown
Chr9:7952401..7952425 21/25 Antisense unknown
Chr9:7952417..7952441 21/25 Antisense unknown
Chr9:90471997..90472021 21/25 Sense unknown
Chr9:90473089..90473113 21/25 Sense unknown
Chr9:90473581..90473605 21/25 Sense unknown
Chr9:90473661..90473685 21/25 Sense unknown
Chr9:90473846..90473870 21/25 Sense unknown
Chr9:90474520..90474544 21/25 Sense unknown
Chr9:90475157..90475181 21/25 Sense unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers