Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311411

Morpholino Name: r3hdm2 MO2
Synonyms: TNeu122i02, Xtnovel40
Target mRNA: r3hdm2

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGGGACATCTTCAGCATAATACAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 25/25
genome
MO
5' CTGTATTATGCTGAAGATGTCCCAT 3'
   |||||||||||||||||||||||||
3' GACATAATACGACTTCTACAGGGTA 5'
5' CTGTATTATGCTGAAGATGTCCCAT 3'
   |||||||||||||||||||||||||
3' GACATAATACGACTTCTACAGGGTA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:147402465..147402489 25/25 Sense target r3hdm2.L
Chr2S:131817318..131817342 25/25 Sense off-target LOC108709856
Chr3L:76531405..76531429 21/25 Antisense off-target cadps2.L
Chr2L:48336705..48336729 21/25 Sense off-target LOC108708040
Chr8L:79383420..79383444 21/25 Sense unknown
Chr1S:123511541..123511565 21/25 Sense unknown
tropicalis 10.0 Chr2:140128184..140128208 25/25 Sense target r3hdm2
Chr3:83777026..83777050 21/25 Antisense off-target kin
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers