Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311368

Morpholino Name: fam214a MO2
Synonyms: TGas096p02, Xtnovel18.2
Target mRNA: atosa

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTCTCTGGCAGGAAGCACTCACAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 24/25
genome
MO
5' CTGTGAGTGCTTCCTGCCAGAGAAG 3'
   |||||||||||||||||||||||||
3' GACACTCACGAAGGACGGTCTCTTC 5'
5' CTGTGAGAGCTTCCTGCCAGAGAAG 3'
   ||||||| |||||||||||||||||
3' GACACTCACGAAGGACGGTCTCTTC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:107196791..107196815 24/25 Antisense target fam214a.L
Chr3S:52369537..52369561 23/25 Sense target fam214a.S
Chr3L:107196791..107196815 24/25 Antisense off-target LOC121401552
Chr8S:71334321..71334345 21/25 Sense unknown
Chr1S:3680567..3680591 21/25 Sense unknown
tropicalis 10.0 Chr3:101829118..101829142 25/25 Antisense target fam214a
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers