Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311304

Morpholino Name: hbegf MO1
Synonyms: TEgg038n05, XtFullback
Target mRNA: hbegf

Morpholino Type: uncategorized morpholino
Sequence: 5' TGAAGTTCATGTTCAGTTAGGAGAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 22/25
genome
MO
5' TTCTCCTAACTGAACATGAACTTCA 3'
   |||||||||||||||||||||||||
3' AAGAGGATTGACTTGTACTTGAAGT 5'
5' GTCTCTTAACTCAACATGAACTTCA 3'
    |||| ||||| |||||||||||||
3' AAGAGGATTGACTTGTACTTGAAGT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:38352503..38352527 22/25 Antisense target hbegf.L
Chr1S:173362613..173362637 21/25 Antisense unknown
tropicalis 10.0 Chr3:31765346..31765370 25/25 Antisense target hbegf
Chr1:170289829..170289853 21/25 Antisense off-target LOC105948047
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers