Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311269

Morpholino Name: dctn2 MO1
Synonyms: DTC50, Dynactin 2, TEgg139n15, XtDCTN-50
Target mRNA: dctn2

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTCGGCCATGTCTTATACGTGAGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' TCTCACGTATAAGACATGGCCGACC 3'
   |||||||||||||||||||||||||
3' AGAGTGCATATTCTGTACCGGCTGG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr2:140666473..140666497 25/25 Sense target dctn2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers