Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310871

Morpholino Name: dhfr MO1
Synonyms:
Target mRNA: dhfr

Morpholino Type: uncategorized morpholino
Sequence: 5' AGAATGTGAACTGCACTGACCTTCA 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' TGAAGGTCAGTGCAGTTCACATTCT 3'
   |||||||||||||||||||||||||
3' ACTTCCAGTCACGTCAAGTGTAAGA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:198205131..198205155 25/25 Antisense target dhfr.L
Chr9_10L:45859817..45859841 21/25 Sense off-target ndrg3.L
Chr5L:52467978..52468002 21/25 Sense off-target srd5a2.L
Chr1L:190776594..190776618 22/25 Antisense unknown
Chr3L:22173031..22173055 21/25 Sense unknown
Chr3S:11860199..11860223 21/25 Sense unknown
Publications
First: The role of folate metabolism in orofacial development and clefting., Dev Biol 2015                                    
Most recent:
View All Papers