Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310750

Morpholino Name: fgf20 MO2
Synonyms:
Target mRNA: fgf20

Morpholino Type: splice blocking morpholino
Sequence: 5' AGGATACCTGCAAATAATAGAAGAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25 22/25
genome
MO
5' ATCTTCTATTATTTGCAGGTATCCT 3'
   |||||||||||||||||||||||||
3' TAGAAGATAATAAACGTCCATAGGA 5'
5' ATTTTGTATGATTTGCAGGTATCCT 3'
   || || ||| |||||||||||||||
3' TAGAAGATAATAAACGTCCATAGGA 5'
5' ATTTTATATGATTTGCAGGTATCCT 3'
   || || ||| |||||||||||||||
3' TAGAAGATAATAAACGTCCATAGGA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:44002915..44002939 22/25 Sense target fgf20.L
Chr1S:31373236..31373260 22/25 Sense target fgf20.S
Chr1L:152428693..152428717 23/25 Sense off-target LOC101027262
Chr1L:152428693..152428717 23/25 Sense off-target LOC121394418
Chr1L:152436583..152436607 23/25 Sense off-target LOC101027262
Chr1L:152436583..152436607 23/25 Sense off-target LOC121400748
Chr1L:152595557..152595581 23/25 Sense off-target LOC101027262
Chr1L:152595557..152595581 23/25 Sense off-target LOC121394413
Chr1L:152598738..152598762 23/25 Sense off-target LOC101027262
Chr1L:152598738..152598762 23/25 Sense off-target LOC108695610
Chr1L:152606649..152606673 23/25 Sense off-target LOC101027262
Chr1L:152606649..152606673 23/25 Sense off-target LOC108695610
Chr1L:152662647..152662671 23/25 Sense off-target LOC121394395
Chr1L:152624921..152624945 23/25 Sense off-target LOC121394401
Chr1L:152643940..152643964 23/25 Sense off-target LOC121394415
Chr1L:152449747..152449771 22/25 Sense off-target LOC101027262
Chr1L:152449747..152449771 22/25 Sense off-target LOC121400757
Chr1L:152453246..152453270 22/25 Sense off-target LOC101027262
Chr1L:152453246..152453270 22/25 Sense off-target LOC121394417
Chr1L:152522574..152522598 22/25 Sense off-target LOC101027262
Chr1L:152522574..152522598 22/25 Sense off-target LOC121394406
Chr1L:152530642..152530666 22/25 Sense off-target LOC101027262
Chr1L:152530642..152530666 22/25 Sense off-target LOC121394411
Chr1L:152545835..152545859 22/25 Sense off-target LOC101027262
Chr1L:152545835..152545859 22/25 Sense off-target LOC121394420
Chr1L:152550686..152550710 22/25 Sense off-target LOC101027262
Chr1L:152550686..152550710 22/25 Sense off-target LOC121394420
Chr1L:152685067..152685091 22/25 Sense off-target LOC108695614
Chr6S:93643074..93643098 21/25 Sense unknown
tropicalis 10.0 Chr1:42117817..42117841 25/25 Sense target fgf20
Chr1:141176654..141176678 23/25 Sense off-target LOC108645686
Chr1:141139998..141140022 22/25 Sense off-target LOC101734149
Chr4:32644804..32644828 22/25 Antisense off-target LOC101733271
Chr6:34491539..34491563 21/25 Antisense off-target glcci1
Chr1:141083776..141083800 21/25 Sense off-target LOC101733867
Chr1:141132128..141132152 21/25 Sense off-target LOC101734149
Chr1:141052458..141052482 23/25 Sense unknown
Chr1:141047152..141047176 22/25 Sense unknown
Chr1:141067466..141067490 22/25 Sense unknown
Chr1:141072755..141072779 22/25 Sense unknown
Chr1:141098145..141098169 22/25 Sense unknown
Chr1:141145310..141145334 22/25 Sense unknown
Chr1:141183528..141183552 22/25 Sense unknown
Chr1:140844849..140844873 21/25 Sense unknown
Chr1:141037733..141037757 21/25 Sense unknown
Publications
First: Amputation-induced reactive oxygen species are required for successful Xenopus tadpole tail regeneration., Nat Cell Biol 2013          
Most recent:
View All Papers