Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310749

Morpholino Name: fgf20 MO1
Synonyms:
Target mRNA: fgf20

Morpholino Type: splice blocking morpholino
Sequence: 5' GGCAGCGATACGTACCAAAGCGGCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 22/25
genome
MO
5' AGCCGCTTTGGTACGTATCGCTGCC 3'
   |||||||||||||||||||||||||
3' TCGGCGAAACCATGCATAGCGACGG 5'
5' AGCCGATTCGGTACGTATCGCTCCC 3'
   ||||| || ||||||||||||| ||
3' TCGGCGAAACCATGCATAGCGACGG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:44005162..44005186 22/25 Sense target fgf20.L
tropicalis 10.0 Chr1:42119835..42119859 25/25 Sense target fgf20
Publications
First: Amputation-induced reactive oxygen species are required for successful Xenopus tadpole tail regeneration., Nat Cell Biol 2013          
Most recent:
View All Papers