Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310747

Morpholino Name: rab11b.1 MO1
Synonyms: rab11b
Target mRNA: rab11b

Morpholino Type: uncategorized morpholino
Sequence: 5' CGTATTCGTCATCTCTGGCTCCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 25/25
genome
MO
5' ATGGGAGCCAGAGATGACGAATACG 3'
   |||||||||||||||||||||||||
3' TACCCTCGGTCTCTACTGCTTATGC 5'
5' ATGGGAGCCAGAGATGACGAATACG 3'
   |||||||||||||||||||||||||
3' TACCCTCGGTCTCTACTGCTTATGC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:110543954..110543978 25/25 Antisense target rab11b.1.L
Chr1S:92055287..92055311 25/25 Antisense target rab11b.1.S
Chr8L:10124420..10124444 21/25 Antisense off-target fnbp1.L
tropicalis 10.0 Chr1:101442000..101442024 25/25 Antisense target rab11b.1
Publications
First: Evolutionarily repurposed networks reveal the well-known antifungal drug thiabendazole to be a novel vascular disrupting agent., PLoS Biol 2012                    
Most recent:
View All Papers