Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310743

Morpholino Name: hdac1 MO1
Synonyms: HDAC1A-MO
Target mRNA: hdac1

Morpholino Type: uncategorized morpholino
Sequence: 5' TCAGCGCCATTTTCCTTCCGCGTCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 23/25
genome
MO
5' AGCCGCGGAAGGAAAATGGCGCTGA 3'
   || ||||||||||||||||||||||
3' TCTGCGCCTTCCTTTTACCGCGACT 5'
5' AGACGCGGAAGGAAAATGGCGCTGA 3'
   |||||||||||||||||||||||||
3' TCTGCGCCTTCCTTTTACCGCGACT 5'
5' AGCCGCCGAAGGAAAATGGCGCTGA 3'
   || ||| ||||||||||||||||||
3' TCTGCGCCTTCCTTTTACCGCGACT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:89729992..89730016 25/25 Sense target hdac1.L
Chr2S:77901112..77901136 23/25 Sense target hdac1.S
Chr9_10L:65258940..65258964 21/25 Sense off-target LOC108701836
tropicalis 10.0 Chr2:86432195..86432219 24/25 Sense target hdac1
Publications
First: HDAC1 Regulates the Proliferation of Radial Glial Cells in the Developing Xenopus Tectum., PLoS One 2015                  
Most recent: A novel role for Ascl1 in the regulation of mesendoderm formation via HDAC-dependent antagonism of VegT., Development 2016                              
View All Papers