Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17306899

Morpholino Name: rab4b MO1
Synonyms: rab4
Target mRNA: rab4b

Morpholino Type: uncategorized morpholino
Sequence: 5' GGAAGTCGTATGTCTCAGACATGAT 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:90298368..90298392 21/25 Antisense off-target hmga2.S
Chr6L:116542870..116542894 21/25 Sense unknown
Publications
First: Rab5 and Rab4 regulate axon elongation in the Xenopus visual system., J Neurosci 2014                    
Most recent:
View All Papers