Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17306437

Morpholino Name: ran MO2
Synonyms:
Target mRNA: ran

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CTTGAGGTTCTCCTTGGGCTGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' ATGGCAGCCCAAGGAGAACCTCAAG 3'
   |||||||||||||||||||||||||
3' TACCGTCGGGTTCCTCTTGGAGTTC 5'
5' ATGGCAGCCCAAGGAGAACCTCAAG 3'
   |||||||||||||||||||||||||
3' TACCGTCGGGTTCCTCTTGGAGTTC 5'
5' ATGGCAGCCCAAGGAGAACCTCAAG 3'
   |||||||||||||||||||||||||
3' TACCGTCGGGTTCCTCTTGGAGTTC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:171394067..171394091 25/25 Sense target ran.L
Chr1S:146493324..146493348 25/25 Sense target ran.S
Chr2L:168931334..168931358 21/25 Sense unknown
tropicalis 10.0 Chr1:157743230..157743254 25/25 Sense target ran
Publications
First: The Inner Nuclear Membrane Protein Nemp1 Is a New Type of RanGTP-Binding Protein in Eukaryotes., PLoS One 2015                                  
Most recent:
View All Papers