Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17252272

Morpholino Name: r3hdm2 MO1
Synonyms:
Target mRNA: r3hdm2

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGGGACATCTTCAGCATAATACA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 25/25
genome
MO
5' TGTATTATGCTGAAGATGTCCCATG 3'
   |||||||||||||||||||||||||
3' ACATAATACGACTTCTACAGGGTAC 5'
5' TGTATTATGCTGAAGATGTCCCATG 3'
   |||||||||||||||||||||||||
3' ACATAATACGACTTCTACAGGGTAC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:147402464..147402488 25/25 Sense target r3hdm2.L
Chr2S:131817317..131817341 25/25 Sense off-target LOC108709856
Chr7L:78126466..78126490 21/25 Sense off-target spa17.L
Chr3L:76531406..76531430 21/25 Antisense off-target cadps2.L
Chr2L:48336704..48336728 21/25 Sense off-target LOC108708040
Chr7L:98639030..98639054 21/25 Antisense off-target LOC108696581
Chr9_10L:128181784..128181808 21/25 Antisense off-target LOC108701742
Chr1S:123511540..123511564 21/25 Sense unknown
Chr2L:78292166..78292190 21/25 Antisense unknown
Chr5L:138234643..138234667 21/25 Antisense unknown
Chr8L:79383419..79383443 21/25 Sense unknown
tropicalis 10.0 Chr2:140128183..140128207 25/25 Sense target r3hdm2
Chr3:83777027..83777051 21/25 Antisense off-target kin
Publications
First: An in vivo screen to identify candidate neurogenic genes in the developing Xenopus visual system., Dev Biol 2015                      
Most recent:
View All Papers