Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17252258

Morpholino Name: fbxw7 MO1
Synonyms:
Target mRNA: fbxw7

Morpholino Type: uncategorized morpholino
Sequence: 5' CCACAGACAGCAGTTCCTGATTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 25/25
genome
MO
5' ATGAATCAGGAACTGCTGTCTGTGG 3'
   |||||||||||||||||||||||||
3' TACTTAGTCCTTGACGACAGACACC 5'
5' ATGAATCAGGAACTGCTGTCTGTGG 3'
   |||||||||||||||||||||||||
3' TACTTAGTCCTTGACGACAGACACC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:58918016..58918040 25/25 Antisense target fbxw7.L
Chr1S:44520154..44520178 25/25 Antisense off-target LOC108706660
Chr9_10L:61544398..61544422 22/25 Antisense off-target zranb3.L
Chr7L:127866988..127867012 22/25 Antisense off-target LOC108696814
Chr4S:47142834..47142858 21/25 Sense off-target gse1.S
Chr5L:139742482..139742506 21/25 Antisense off-target pak2.L
Chr5L:32412628..32412652 21/25 Sense off-target xpo1.L
Chr5S:36860561..36860585 21/25 Sense off-target utrn.S
Chr8S:3802230..3802254 21/25 Antisense off-target fntb.S
Chr1L:184015328..184015352 21/25 Antisense off-target snx24.L
Chr4L:13229231..13229255 21/25 Antisense off-target hipk3.L
Chr6L:34441421..34441445 21/25 Sense off-target umad1.L
Chr6S:67258425..67258449 21/25 Antisense off-target cdh12.S
Chr4L:25682487..25682511 21/25 Sense off-target rassf7.L
Chr4L:25684272..25684296 21/25 Sense off-target rassf7.L
Chr8L:96383388..96383412 21/25 Sense off-target dlgap5.L
Chr9_10S:70081659..70081683 21/25 Sense off-target sestd1.S
Chr7L:43841612..43841636 21/25 Antisense off-target macroh2a2.L
Chr3L:30363888..30363912 21/25 Sense off-target LOC121401226
Chr5L:19292653..19292677 21/25 Sense off-target LOC108716497
Chr6L:79184665..79184689 21/25 Sense off-target LOC108719073
Chr2S:146405479..146405503 21/25 Sense unknown
Chr2S:160638200..160638224 21/25 Sense unknown
Chr3L:21083114..21083138 21/25 Antisense unknown
Chr3L:72290021..72290045 21/25 Sense unknown
Chr5L:107094629..107094653 21/25 Sense unknown
Chr7S:81082924..81082948 21/25 Sense unknown
Chr9_10L:112026097..112026121 21/25 Antisense unknown
tropicalis 10.0 Chr1:55474983..55475007 25/25 Antisense target fbxw7
Chr6:81611377..81611401 21/25 Antisense off-target cdh12
Chr7:44345435..44345459 21/25 Sense off-target usp54
Chr5:65102218..65102242 21/25 Antisense off-target hivep2
Chr1:48500157..48500181 21/25 Antisense unknown
Publications
First: An in vivo screen to identify candidate neurogenic genes in the developing Xenopus visual system., Dev Biol 2015                      
Most recent:
View All Papers