Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17252252

Morpholino Name: dio3 MO1
Synonyms:
Target mRNA: dio3

Morpholino Type: uncategorized morpholino
Sequence: 5' GCAGTGCAACATGGTGCTCAGCCCT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' AGGGCTGAGCACCATGTTGCACTGC 3'
   |||||||||||||||||||||||||
3' TCCCGACTCGTGGTACAACGTGACG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:88356747..88356771 25/25 Antisense target dio3.L
Chr1L:199556074..199556098 22/25 Sense off-target ankra2.L
Chr2S:38487805..38487829 22/25 Antisense off-target LOC108709348
Chr8S:4031749..4031773 21/25 Antisense off-target LOC121397575
Chr1L:67633141..67633165 21/25 Sense unknown
tropicalis 10.0 Chr8:105761356..105761380 21/25 Sense off-target ubr1
Publications
First: An in vivo screen to identify candidate neurogenic genes in the developing Xenopus visual system., Dev Biol 2015                      
Most recent:
View All Papers