Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17251732

Morpholino Name: cby1 MO1
Synonyms:
Target mRNA: cby1

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CGTGTTCCCGAATAAGGGCATCTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 22/25 25/25
genome
MO
5' CAAGATGCCCCTATTCGGGAACACA 3'
    ||||||||| ||||||||||||| 
3' CTTCTACGGGAATAAGCCCTTGTGC 5'
5' GAAGATGCCCTTATTCGGGAACACG 3'
   |||||||||||||||||||||||||
3' CTTCTACGGGAATAAGCCCTTGTGC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4S:100489327..100489351 25/25 Antisense target cby1.S
tropicalis 10.0 Chr4:120460811..120460835 22/25 Sense target cby1
Publications
First: Chibby functions in Xenopus ciliary assembly, embryonic development, and the regulation of gene expression., Dev Biol 2014                      
Most recent:
View All Papers