Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17251718

Morpholino Name: ventx2.1 MO2
Synonyms:
Target mRNA: ventx2

Morpholino Type: uncategorized morpholino
Sequence: 5' GTCATCTTGTCTGTATTAGTCCT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 23/23
genome
MO
5' AGGACTAATACAGACAAGATGAC 3'
   |||||||||||||||||||||||
3' TCCTGATTATGTCTGTTCTACTG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:21807366..21807388 23/23 Sense target ventx2.1.L
Chr7S:16928492..16928514 23/23 Sense target ventx2.1.S
Chr7L:21777306..21777328 23/23 Antisense off-target ventx2.2.L
Chr7S:16903339..16903361 23/23 Antisense off-target ventx2.2.S
Chr9_10S:47150869..47150891 20/23 Antisense off-target LOC108702867
Chr3S:58861531..58861553 19/23 Sense off-target snx1.S
Chr1S:29817282..29817304 19/23 Antisense off-target cracd.S
Chr2L:100650326..100650348 20/23 Antisense unknown
Chr3S:124633660..124633682 19/23 Sense unknown
Chr3S:89312728..89312750 19/23 Antisense unknown
Chr6S:114319289..114319311 19/23 Antisense unknown
tropicalis 10.0 Chr1:77417791..77417813 19/23 Sense off-target grid2
Chr6:128402506..128402528 19/23 Antisense off-target vps13b
Chr2:61341394..61341416 20/23 Antisense unknown
Chr2:145515362..145515384 19/23 Sense unknown
Publications
First: The opposing homeobox genes Goosecoid and Vent1/2 self-regulate Xenopus patterning., EMBO J 2007                
Most recent: A gene regulatory network underlying the formation of pre-placodal ectoderm in Xenopus laevis., BMC Biol 2018                              
View All Papers