Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17251707

Morpholino Name: c12orf43 MO1
Synonyms: custos-MO
Target mRNA: c1h12orf43

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CGCCGCCATCTTACTTGTTGGTCA 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr6:12581287..12581310 20/24 Sense off-target tbrg4
Publications
First: Custos controls β-catenin to regulate head development during vertebrate embryogenesis., Proc Natl Acad Sci U S A 2014                                  
Most recent:
View All Papers