Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17251697

Morpholino Name: pax8 MO2
Synonyms:
Target mRNA: pax8

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' CTAGTCCCTGGTAAATCCACAGTGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 22/25 25/25
genome
MO
5' GCACTGTGGATTTACCAGGGACTCG 3'
   ||||||||||||||||||||||| |
3' CGTGACACCTAAATGGTCCCTGATC 5'
5' GCTCTGTGGATTTACCAGGGACTCA 3'
   || ||||||||||||||||||||  
3' CGTGACACCTAAATGGTCCCTGATC 5'
5' GCACTGTGGATTTACCAGGGACTAG 3'
   |||||||||||||||||||||||||
3' CGTGACACCTAAATGGTCCCTGATC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:27512614..27512638 25/25 Sense target pax8.S
Chr3L:133553970..133553994 22/25 Antisense target pax8.L
tropicalis 10.0 Chr3:125804949..125804973 24/25 Antisense target pax8
Chr8:10886529..10886553 21/25 Antisense off-target LOC116406899
Publications
First: Pax8 and Pax2 are specifically required at different steps of Xenopus pronephros development., Dev Biol 2015                              
Most recent: Hnf1b renal expression directed by a distal enhancer responsive to Pax8., Sci Rep 2022              
View All Papers