Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17251696

Morpholino Name: pax8 MO1
Synonyms:
Target mRNA: pax8

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' CAGAGCAGCTCCTTGTAGCCAATGT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' ACATTGGCTACAAGGAGCTGCTCTG 3'
   |||||||||||||||||||||||||
3' TGTAACCGATGTTCCTCGACGAGAC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:133553951..133553975 25/25 Antisense target pax8.L
Chr8S:28632472..28632496 21/25 Antisense off-target kcnt1.S
Chr7S:16481552..16481576 21/25 Antisense unknown
tropicalis 10.0 Chr7:48765340..48765364 21/25 Antisense off-target grid1
Chr8:25773643..25773667 21/25 Antisense unknown
Publications
First: Pax8 and Pax2 are specifically required at different steps of Xenopus pronephros development., Dev Biol 2015                              
Most recent: Hnf1b renal expression directed by a distal enhancer responsive to Pax8., Sci Rep 2022              
View All Papers