Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17251695

Morpholino Name: pax2 MO3
Synonyms: MoPax2.2
Target mRNA: pax2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TCTGCCTTGCAGTGCATATCCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 24/24 24/24
genome
MO
5' CATGGATATGCACTGCAAGGCAGA 3'
   ||||||||||||||||||||||||
3' GTACCTATACGTGACGTTCCGTCT 5'
5' CATGGATATGCACTGCAAGGCAGA 3'
   ||||||||||||||||||||||||
3' GTACCTATACGTGACGTTCCGTCT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:40853866..40853889 24/24 Antisense target pax2.L
Chr7S:32158667..32158690 24/24 Antisense off-target LOC108697493
Chr7L:47411093..47411116 20/24 Antisense off-target grid1.L
Chr2L:39913756..39913779 20/24 Sense off-target LOC108707447
Chr3L:23106154..23106177 20/24 Sense off-target LOC108710783
tropicalis 10.0 Chr7:43096837..43096860 24/24 Antisense target pax2
Chr4:71424308..71424331 20/24 Antisense off-target pop4
Chr2:174929877..174929900 20/24 Sense off-target c2cd3
Chr2:39800129..39800152 20/24 Sense off-target il1rapl1
Chr2:174929877..174929900 20/24 Sense off-target LOC116406442
Chr9:32621173..32621196 21/24 Antisense unknown
Publications
First: Pax8 and Pax2 are specifically required at different steps of Xenopus pronephros development., Dev Biol 2015                              
Most recent: Hnf1b renal expression directed by a distal enhancer responsive to Pax8., Sci Rep 2022              
View All Papers