Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17251689

Morpholino Name: fezf2 MO1
Synonyms:
Target mRNA: fezf2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' AAAGGCGCAGCCATCCTGGCGACAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' TTGTCGCCAGGATGGCTGCGCCTTT 3'
   |||||||||||||||||||||||||
3' AACAGCGGTCCTACCGACGCGGAAA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr4:145784367..145784391 25/25 Antisense target fezf2
Publications
First: Xenopus mutant reveals necessity of rax for specifying the eye field which otherwise forms tissue with telencephalic and diencephalic character., Dev Biol 2014                    
Most recent:
View All Papers