Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17251668

Morpholino Name: fermt3 MO1
Synonyms:
Target mRNA: fermt3

Morpholino Type: uncategorized morpholino
Sequence: 5' GATGTCTTGATTCCAGCCATCCTTA 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 24/25
genome
MO
5' TAAGGATGGCTGGAATCAAAACATC 3'
   ||||||||||||||||||| |||||
3' ATTCCTACCGACCTTAGTTCTGTAG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:26635461..26635485 25/25 Sense off-target LOC108713911
tropicalis 10.0 Chr4:35650555..35650579 24/25 Sense target fermt3
Publications
First: Diverse functions of kindlin/fermitin proteins during embryonic development in Xenopus laevis., Mech Dev 2014                  
Most recent:
View All Papers