Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17251667

Morpholino Name: fermt2 MO1
Synonyms:
Target mRNA: fermt2

Morpholino Type: uncategorized morpholino
Sequence: 5' GCATCCGTATACCATCCAAAGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genome
MO
5' ATGGCTTTGGATGGTATAAGGATGC 3'
   |||||||||||||||||| ||||||
3' TACCGAAACCTACCATATGCCTACG 5'
5' ATGGCTTTGGATGGTATACGGATGC 3'
   |||||||||||||||||||||||||
3' TACCGAAACCTACCATATGCCTACG 5'
5' ATGGCTTTGGATGGTATACGGATGC 3'
   |||||||||||||||||||||||||
3' TACCGAAACCTACCATATGCCTACG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:85578658..85578682 25/25 Sense target fermt2.L
Chr8S:14146894..14146918 25/25 Antisense target fermt2.S
Chr9_10S:54819650..54819674 22/25 Sense unknown
tropicalis 10.0 Chr8:94647721..94647745 24/25 Sense target fermt2
Publications
First: Diverse functions of kindlin/fermitin proteins during embryonic development in Xenopus laevis., Mech Dev 2014                  
Most recent:
View All Papers