Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17251641

Morpholino Name: irx3 MO3
Synonyms: Irx3(2)-MO
Target mRNA: irx3

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GAATCCCCTTTTATGACCTGACTTT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' AAAGTCAGGTCATAAAAGGGGATTC 3'
   |||||||||||||||||||||||||
3' TTTCAGTCCAGTATTTTCCCCTAAG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:33778179..33778203 25/25 Sense target irx3.L
Chr5L:56225520..56225544 21/25 Antisense unknown
tropicalis 10.0 Chr4:25260828..25260852 21/25 Antisense unknown
Chr5:136563675..136563699 21/25 Sense unknown
Chr9:77325093..77325117 21/25 Antisense unknown
Publications
First: The prepattern transcription factor Irx3 directs nephron segment identity., Genes Dev 2007                  
Most recent:
View All Papers