Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250624

Morpholino Name: wnt8a MO3
Synonyms: Xwnt-8 MO, Xwnt8 MO
Target mRNA: wnt8a

Morpholino Type: uncategorized morpholino
Sequence: 5' GAACAAAGTGGTGTTTTGCATGATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 22/25 25/25
genome
MO
5' CATCATGAAGAACACCACTTTGTTT 3'
   ||||||| | |||||||||||||| 
3' GTAGTACGTTTTGTGGTGAAACAAG 5'
5' CATCATGCAAAACACCACTTTGTTC 3'
   |||||||||||||||||||||||||
3' GTAGTACGTTTTGTGGTGAAACAAG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:38025867..38025891 25/25 Sense target wnt8a.L
Chr1S:157650159..157650183 21/25 Antisense off-target snx2.S
Chr1S:175623243..175623267 21/25 Sense off-target mast4.S
Chr5L:12913119..12913143 21/25 Antisense off-target kcnk2.L
Chr6S:18398924..18398948 21/25 Antisense unknown
tropicalis 10.0 Chr3:31431158..31431182 22/25 Sense target wnt8a
Publications
First: Embryonic dorsal-ventral signaling: secreted frizzled-related proteins as inhibitors of tolloid proteinases., Cell 2006          
Most recent: Roles of two types of heparan sulfate clusters in Wnt distribution and signaling in Xenopus., Nat Commun 2017                                                    
View All Papers