Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250622

Morpholino Name: wnt8a MO1
Synonyms: W8MO, Wnt8, Wnt8 MO, Wnt8MO, Xwnt8
Target mRNA: wnt8a

Morpholino Type: uncategorized morpholino
Sequence: 5' AAAGTGGTGTTTTGCATGATGAAGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 21/25 25/25
genome
MO
5' TCTCCATCATGAAGAACACCACTTT 3'
    || ||||||| | |||||||||||
3' GGAAGTAGTACGTTTTGTGGTGAAA 5'
5' CCTTCATCATGCAAAACACCACTTT 3'
   |||||||||||||||||||||||||
3' GGAAGTAGTACGTTTTGTGGTGAAA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:38025871..38025895 25/25 Sense target wnt8a.L
Chr5L:138132974..138132998 22/25 Sense off-target rbp1.L
Chr1S:175623247..175623271 21/25 Sense off-target mast4.S
Chr3L:89857114..89857138 21/25 Antisense off-target sfmbt2.L
Chr3L:89857114..89857138 21/25 Antisense off-target LOC121401519
Chr1S:78245538..78245562 21/25 Sense unknown
Chr5L:14960051..14960075 21/25 Antisense unknown
tropicalis 10.0 Chr3:31431162..31431186 21/25 Sense target wnt8a
Chr7:51707839..51707863 21/25 Sense off-target nrg3
Chr2:125921471..125921495 22/25 Antisense unknown
Chr1:42111133..42111157 21/25 Antisense unknown
Chr3:19295367..19295391 21/25 Sense unknown
Chr4:49902221..49902245 21/25 Antisense unknown
Publications
First: FGF8, Wnt8 and Myf5 are target genes of Tbx6 during anteroposterior specification in Xenopus embryo., Dev Biol 2006                      
Most recent: Dkk2 promotes neural crest specification by activating Wnt/β-catenin signaling in a GSK3β independent manner., Elife 2018                              
View All Papers