Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250607

Morpholino Name: wnt11b MO1
Synonyms: Wnt-11 MO, Wnt11, Wnt11-MO, XWnt-11 MO, XWnt-11 morpholino, wnt11 MO, wnt11-2ome, wnt11b
Target mRNA: wnt11b

Morpholino Type: uncategorized morpholino
Sequence: 5' CCAGTGACGGGTCGGAGCCATTGGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 21/25 25/25
genome
MO
5' ACCAATGGCTCTAATCCGTCACTGT 3'
   |||||||||||  | ||||||||| 
3' TGGTTACCGAGGCTGGGCAGTGACC 5'
5' ACCAATGGCTCCGACCCGTCACTGG 3'
   |||||||||||||||||||||||||
3' TGGTTACCGAGGCTGGGCAGTGACC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:34311439..34311463 25/25 Antisense target wnt11b.L
tropicalis 10.0 Chr8:43798342..43798366 21/25 Antisense target wnt11b
Publications
First: Wnt-11 activation of a non-canonical Wnt signalling pathway is required for cardiogenesis., Nature 2002  
Most recent: Formation of a "Pre-mouth Array" from the Extreme Anterior Domain Is Directed by Neural Crest and Wnt/PCP Signaling., Cell Rep 2016              
View All Papers