Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250601

Morpholino Name: wee2 MO1
Synonyms: MO-Wee1, Wee1
Target mRNA: wee2

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCATTCTCATTGTCACCACCTTGG 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' CCAAGGTGGTGACAATGAGAATGGC 3'
   |||||||||||||||||||||||||
3' GGTTCCACCACTGTTACTCTTACCG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:3532404..3532428 25/25 Sense target wee2.S
Chr3L:150436391..150436415 22/25 Antisense unknown
Publications
First: Morphogenesis during Xenopus gastrulation requires Wee1-mediated inhibition of cell proliferation., Development 2004     
Most recent: Somitic mesoderm morphogenesis is necessary for neural tube closure during Xenopus development., Front Cell Dev Biol 2022     
View All Papers