Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250588

Morpholino Name: vegt MO4
Synonyms: VegT-MO, vegt, vegt MO
Target mRNA: vegt

Morpholino Type: uncategorized morpholino
Sequence: 5' CCCGACAGCAGTTTCTCATTCCAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genome
MO
5' GCTGCAATGAGAAACTGCTGTCAGG 3'
   |||| ||||||||||||||||| ||
3' CGACCTTACTCTTTGACGACAGCCC 5'
5' GCTGGAATGAGAAACTGCTGTCGGG 3'
   |||||||||||||||||||||||||
3' CGACCTTACTCTTTGACGACAGCCC 5'
5' GCTGGAATGAGAAACTGCTGTCGGG 3'
   |||||||||||||||||||||||||
3' CGACCTTACTCTTTGACGACAGCCC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:165681274..165681298 25/25 Sense target vegt.L
Chr1S:142004130..142004154 25/25 Sense target vegt.S
Chr4S:55308864..55308888 21/25 Sense off-target cngb1.S
Chr5L:29604100..29604124 21/25 Sense unknown
tropicalis 10.0 Chr1:152863076..152863100 23/25 Sense target vegt
Chr5:30906646..30906670 21/25 Sense unknown
Publications
First: Vegetal localization of maternal mRNAs is disrupted by VegT depletion., Dev Biol 2001      
Most recent: Ascl1 represses the mesendoderm induction in Xenopus., Acta Biochim Biophys Sin (Shanghai) 2016  
View All Papers