Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250573

Morpholino Name: usp4 MO1
Synonyms: USP4
Target mRNA: usp4

Morpholino Type: uncategorized morpholino
Sequence: 5' TACCTCCACCTCCTCCCTCTGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/24 22/24 22/24
genome
MO
5' TGGCAGAGGAAGGAGGTGGAGGTA 3'
     ||||||| ||||||||||||||
3' TACGTCTCCCTCCTCCACCTCCAT 5'
5' TGGCAGAGGGAGGAGGTGGAGGTA 3'
     ||||||||||||||||||||||
3' TACGTCTCCCTCCTCCACCTCCAT 5'
5' TGGCAGAGGGAGGAGGTGGAGGTA 3'
     ||||||||||||||||||||||
3' TACGTCTCCCTCCTCCACCTCCAT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:124537381..124537404 22/24 Antisense target usp4.L
Chr4S:104710311..104710334 22/24 Antisense target usp4.S
Chr4L:131786288..131786311 21/24 Antisense off-target rbsn.L
Chr4L:84256529..84256552 21/24 Antisense off-target ptprf.L
Chr1L:156345677..156345700 20/24 Sense off-target sf3a1.L
Chr7L:135301059..135301082 20/24 Sense off-target fli1b.L
Chr7L:63771968..63771991 20/24 Antisense off-target rnf20.L
Chr3L:47578772..47578795 20/24 Sense off-target tcerg1.L
Chr5L:41651310..41651333 20/24 Antisense off-target arhgef33.L
Chr5S:32125471..32125494 20/24 Antisense off-target XB5862139.S
Chr6L:163551665..163551688 20/24 Antisense off-target LOC108718623
Chr6L:44848594..44848617 20/24 Sense off-target LOC108718909
Chr9_10L:6490883..6490906 20/24 Antisense off-target LOC108700860
Chr1L:94683118..94683141 20/24 Antisense unknown
Chr2L:105983226..105983249 20/24 Antisense unknown
Chr2S:162993196..162993219 20/24 Sense unknown
Chr4S:52821993..52822016 20/24 Antisense unknown
Chr7S:104577634..104577657 20/24 Antisense unknown
Chr8L:46374007..46374030 20/24 Sense unknown
tropicalis 10.0 Chr4:125802490..125802513 21/24 Antisense target usp4
Chr1:102117010..102117033 21/24 Antisense off-target adamts10
Chr9:28282961..28282984 20/24 Sense off-target unkl
Chr4:89405085..89405108 20/24 Antisense off-target ptprf
Chr5:26089571..26089594 20/24 Sense off-target plcb1
Chr2:145319152..145319175 20/24 Sense off-target znf385a
Chr7:122506612..122506635 20/24 Sense off-target LOC100487412
Chr5:41727554..41727577 20/24 Antisense unknown
Chr10:38861854..38861877 20/24 Antisense unknown
Publications
First: USP15 is a deubiquitylating enzyme for receptor-activated SMADs., Nat Cell Biol 2011  
Most recent:
View All Papers