Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250569

Morpholino Name: unc5b MO2
Synonyms: Unc5B-UTR MO
Target mRNA: unc5b

Morpholino Type: uncategorized morpholino
Sequence: 5' ACAATGCCAAGGTGTCCCGCAAGCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genome
MO
5' TGCTTGCGGGACACCTTGGCATTAT 3'
   ||||||||||||||||||||||| |
3' ACGAACGCCCTGTGGAACCGTAACA 5'
5' TGCTTGCGGGACACCTTGGCATTGT 3'
   |||||||||||||||||||||||||
3' ACGAACGCCCTGTGGAACCGTAACA 5'
5' TGCTTGCGGGACACCTTGGCGTTGT 3'
   |||||||||||||||||||| ||||
3' ACGAACGCCCTGTGGAACCGTAACA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:45050349..45050373 25/25 Sense target unc5b.L
Chr7S:35900231..35900255 24/25 Sense target unc5b.S
Chr4S:76129554..76129578 24/25 Sense unknown
tropicalis 10.0 Chr7:46910996..46911020 24/25 Sense target unc5b
Publications
First: Unc5B interacts with FLRT3 and Rnd1 to modulate cell adhesion in Xenopus embryos., PLoS One 2009                
Most recent:
View All Papers