Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250567

Morpholino Name: unc45b MO2
Synonyms: unc45b ATG
Target mRNA: unc45b

Morpholino Type: uncategorized morpholino
Sequence: 5' CCTTTAGCTGCACTGGGTCTTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genome
MO
5' ATGGAAGACCCAGTGCAGCTAAAGG 3'
   |||||||||||||||||||||||||
3' TACCTTCTGGGTCACGTCGATTTCC 5'
5' ATGGAAGACCCAGTGCAGCTAAAGG 3'
   |||||||||||||||||||||||||
3' TACCTTCTGGGTCACGTCGATTTCC 5'
5' ATGGAAGACCCCGTGCAGCTAAAGG 3'
   ||||||||||| |||||||||||||
3' TACCTTCTGGGTCACGTCGATTTCC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:97297702..97297726 25/25 Antisense target unc45b.L
Chr2S:85441128..85441152 24/25 Antisense target unc45b.S
Chr9_10L:130583010..130583034 21/25 Sense unknown
tropicalis 10.0 Chr2:93485857..93485881 25/25 Antisense target unc45b
Publications
First: Paralysis and delayed Z-disc formation in the Xenopus tropicalis unc45b mutant dicky ticker., BMC Dev Biol 2010                      
Most recent:
View All Papers