Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250566

Morpholino Name: unc45b MO1
Synonyms: unc45b splice
Target mRNA: unc45b

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCACACATTATTCTTACCCAGTAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' GTACTGGGTAAGAATAATGTGTGCT 3'
   |||||||||||||||||||||||||
3' CATGACCCATTCTTATTACACACGA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:73267278..73267302 21/25 Antisense off-target camk2d.L
Chr3L:114127799..114127823 21/25 Sense off-target sema4b.L
Chr2L:42613996..42614020 21/25 Antisense unknown
Chr6L:89722408..89722432 21/25 Sense unknown
tropicalis 10.0 Chr2:93489965..93489989 25/25 Antisense target unc45b
Chr2:92721213..92721237 21/25 Sense off-target bcas3
Chr2:74527933..74527957 21/25 Sense off-target kiaa1324
Chr2:99799667..99799691 21/25 Sense unknown
Publications
First: Paralysis and delayed Z-disc formation in the Xenopus tropicalis unc45b mutant dicky ticker., BMC Dev Biol 2010                      
Most recent:
View All Papers